WormBase Tree Display for Variation: WBVar00252341

WBVar00252341 Name: Public_name: tm3733
    Other_name: C10G8.6.1:c.127-65_278del
    HGVSg: CHROMOSOME_V:g.5317406_5317622del
  Sequence_details: SMap: S_parent: Sequence: C10G8
    Flanking_sequences: ttataatgtgcatcaagccacaaattttgt ctagctttttgtattaaagttttgaataaa
    Mapping_target: C10G8
    Source_location: 7 CHROMOSOME_V 5317405 5317623 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3733_external
      tm3733_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3733
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000455
    Transcript: C10G8.6.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C10G8.6.1:c.127-65_278del
        cDNA_position: ?-419
        CDS_position: ?-278
        Protein_position: ?-93
        Intron_number: 3/7
        Exon_number: 4/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000117 Paper_evidence: WBPaper00036106
        Curator_confirmed: WBPerson2021
        Remark: ceh-34(tm3733) mutant animals are 100% lethal at the L1 stage Paper_evidence: WBPaper00036106
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000852 Paper_evidence: WBPaper00036106
        Curator_confirmed: WBPerson2021
        Remark: Larvae do not have any functional CCs Paper_evidence: WBPaper00036106
            Curator_confirmed: WBPerson2021
      WBPhenotype:0001426 Paper_evidence: WBPaper00036106
        Curator_confirmed: WBPerson2021
        Remark: GFP secreted from the BWMs (myo-3p::secreted GFP) diffuses throughout the pseudocoelom instead of being taken up by the CCs (unlike wt) Paper_evidence: WBPaper00036106
            Curator_confirmed: WBPerson2021
  Reference: WBPaper00036106
  Remark: 13788/13789-14005/14006 (217 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele