WormBase Tree Display for Variation: WBVar00252369

WBVar00252369 Name: Public_name: tm3761
    Other_name: R06A4.9b.1:c.227_592del
      CE21113:p.Thr281_Ter403delinsIle
      CE48640:p.Thr76_Ter198delinsIle
      R06A4.9c.1:c.*496_*861del
      R06A4.9a.1:c.842_1207del
    HGVSg: CHROMOSOME_II:g.14359804_14360216del
  Sequence_details: SMap: S_parent: Sequence: R06A4
    Flanking_sequences: aaggtctgatcgcgacaggatctcgtgata tcctggccaccggatccaacgacaataaca
    Mapping_target: R06A4
    Source_location: 7 CHROMOSOME_II 14359803 14360217 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3761_external
      tm3761_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3761
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00011051
    Transcript: R06A4.9b.1 (11)
      R06A4.9a.1 (11)
      R06A4.9c.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: R06A4.9c.1:c.*496_*861del
        cDNA_position: 1277-1642
        Intron_number: 6/7
        Exon_number: 6-7/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
            Laboratory_evidence: FX
  Remark: 8950/8951-9363/9364 (413 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele