WormBase Tree Display for Variation: WBVar00252406

WBVar00252406 Name: Public_name: tm3799
    Other_name: F10C2.6.1:c.331-96_472del
    HGVSg: CHROMOSOME_V:g.12049414_12049699del
  Sequence_details: SMap: S_parent: Sequence: F10C2
    Flanking_sequences: aaatcgcgttattaaatgttgaattttttc ttcgttcagaatttgtgcacaatgttcgga
    Mapping_target: F10C2
    Source_location: 7 CHROMOSOME_V 12049413 12049700 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3799_external
      tm3799_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3799
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001095
    Transcript: F10C2.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F10C2.6.1:c.331-96_472del
        cDNA_position: ?-473
        CDS_position: ?-472
        Protein_position: ?-158
        Intron_number: 3-4/8
        Exon_number: 4-5/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 26700/26701-26986/26987 (286 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele