WormBase Tree Display for Variation: WBVar00252455

WBVar00252455 Name: Public_name: tm3862
    Other_name: CE05163:p.Thr157AsnfsTer14
      B0035.5.1:c.470_822del
    HGVSg: CHROMOSOME_IV:g.11318403_11318813del
  Sequence_details: SMap: S_parent: Sequence: B0035
    Flanking_sequences: ttcctccatcagttttcaacgtggtttcta actttagtcgccatggagaaaccagcaagt
    Mapping_target: B0035
    Source_location: 7 CHROMOSOME_IV 11318402 11318814 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3862_external
      tm3862_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3862
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007108
    Transcript: B0035.5.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 24113/24114-24524/24525 (411 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele