WormBase Tree Display for Variation: WBVar00252465
expand all nodes | collapse all nodes | view schema
WBVar00252465 | Name | Public_name | tm3874 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F09E8.7b.1:c.960+74_961-24delinsA | |||||||
F09E8.7a.1:c.1035+74_1036-24delinsA | ||||||||
HGVSg | CHROMOSOME_IV:g.13175553_13176068delinsT | |||||||
Sequence_details | SMap | S_parent | Sequence | F58D2 | ||||
Flanking_sequences | ggagaatctgaaattaacattttacttgtg | ggaaataaggaaatgtatgactttttaatt | ||||||
Mapping_target | F58D2 | |||||||
Source_location | 7 | CHROMOSOME_IV | 13175552 | 13176069 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | T | ||||||
Deletion | ||||||||
PCR_product | tm3874_external | |||||||
tm3874_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 3874 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002974 | ||||||
Transcript | F09E8.7a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | F09E8.7a.1:c.1035+74_1036-24delinsA | |||||||
Intron_number | 5/9 | |||||||
F09E8.7b.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
HGVSc | F09E8.7b.1:c.960+74_961-24delinsA | |||||||
Intron_number | 6/10 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark (3) | ||||||||
Method | NBP_knockout_allele |