WormBase Tree Display for Variation: WBVar00252488

WBVar00252488 Name: Public_name: tm3908
    Other_name: C16D9.2.1:c.1238_1435del
      CE44893:p.Lys413_Ter479delinsAsn
    HGVSg: CHROMOSOME_V:g.8236128_8236453del
  Sequence_details: SMap: S_parent: Sequence: C16D9
    Flanking_sequences: TCTCAGTCCGATAAACTTTATTGTCGGCAT TTGTATCCATCTCTCCAACTGTTTTTAATT
    Mapping_target: C16D9
    Type_of_mutation: Deletion
    PCR_product: tm3908_external
      tm3908_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3908
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00004395
    Transcript: C16D9.2.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 7640/7641-7964/7965 (324 bp deletion)
    This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele