WormBase Tree Display for Variation: WBVar00252524

WBVar00252524 Name: Public_name: tm3953
    Other_name: C50F2.3.1:c.182_696del
      CE08909:p.Phe61Ter
    HGVSg: CHROMOSOME_I:g.3877294_3877853del
  Sequence_details: SMap: S_parent: Sequence: C50F2
    Flanking_sequences: tgcagaacaaatctcctgccaagcagatgt gatttgatctcaaagaatccagtaaagatc
    Mapping_target: C50F2
    Source_location: 7 CHROMOSOME_I 3877293 3877854 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3953_external
      tm3953_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3953
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00016837
    Transcript: C50F2.3.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 998/999-1558/1559 (560 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele