WormBase Tree Display for Variation: WBVar00252534

WBVar00252534 Name: Public_name: tm3969
    Other_name: C04G2.7.1:c.184_280+52delinsTTTTTTT
    HGVSg: CHROMOSOME_IV:g.10108893_10109219delinsAAAAAAA
  Sequence_details: SMap: S_parent: Sequence: C04G2
    Flanking_sequences: aaaaaaggatgattcaaaaggaaaaaaaaa accatgttgtgacatttcgactatttgagc
    Mapping_target: C04G2
    Source_location: 7 CHROMOSOME_IV 10108892 10109220 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AAAAAAA
      Deletion
    PCR_product: tm3969_external
      tm3969_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3969
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001204
    Transcript: C04G2.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C04G2.7.1:c.184_280+52delinsTTTTTTT
        cDNA_position: 289-?
        CDS_position: 184-?
        Protein_position: 62-?
        Intron_number: 3-4/8
        Exon_number: 3-4/9
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 22005/22006-AAAAAAA-22332/22333 (327 bp deletion + 7 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele