WormBase Tree Display for Variation: WBVar00252566

WBVar00252566 Name: Public_name: tm4007
    Other_name: Y48G9A.3.1:c.6461_6652+111delinsAATCCGGAGTTTCTCT
    HGVSg: CHROMOSOME_III:g.2192523_2192825delinsAATCCGGAGTTTCTCT
  Sequence_details: SMap: S_parent: Sequence: Y48G9A
    Flanking_sequences: tcgcaaaatccggagtttctctagccgaaa atgagcaaaaatcatatatttttagtcgaa
    Mapping_target: Y48G9A
    Source_location: 7 CHROMOSOME_III 2192522 2192826 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AATCCGGAGTTTCTCT
      Deletion
    PCR_product: tm4007_external
      tm4007_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4007
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00021697
    Transcript: Y48G9A.3.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y48G9A.3.1:c.6461_6652+111delinsAATCCGGAGTTTCTCT
        cDNA_position: 6500-?
        CDS_position: 6461-?
        Protein_position: 2154-?
        Intron_number: 24/29
        Exon_number: 24/30
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 112654/112655-AATCCGGAGTTTCTCT-112957/112958 (303 bp deletion + 16 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele