WormBase Tree Display for Variation: WBVar00252615

WBVar00252615 Name: Public_name: tm4060
    Other_name: CE06504:p.Gly78LysfsTer12
      T25B9.5b.1:c.246_669del
      T25B9.5a.1:c.231_654del
      CE49850:p.Gly83LysfsTer12
    HGVSg: CHROMOSOME_IV:g.10753544_10754018del
  Sequence_details: SMap: S_parent: Sequence: T25B9
    Flanking_sequences: ttgagcttcattgcaaaactcttggatttg aataacactccatgatacacgtgtagattg
    Mapping_target: T25B9
    Source_location: 7 CHROMOSOME_IV 10753543 10754019 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4060_external
      tm4060_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4060
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00012011
    Transcript: T25B9.5a.1 (11)
      T25B9.5b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 8541/8542-9016/9017 (475 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele