WormBase Tree Display for Variation: WBVar00252636
expand all nodes | collapse all nodes | view schema
WBVar00252636 | Name | Public_name | tm4085 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | Y74C9A.2a.3:c.50-192_103del | |||||||
Y74C9A.2a.2:c.50-192_103del | ||||||||
Y74C9A.2a.1:c.50-192_103del | ||||||||
HGVSg | CHROMOSOME_I:g.14759_15004del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y74C9A | ||||
Flanking_sequences | aaaactacattaattctttaaatgacacgc | aactgtacagtctggagaaagagaacggag | ||||||
Mapping_target | Y74C9A | |||||||
Source_location | 7 | CHROMOSOME_I | 14758 | 15005 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm4085_external | |||||||
tm4085_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00056064 | |||||||
WBStrain00056096 | ||||||||
Laboratory | FX | |||||||
OJ | ||||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 4085 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00022276 | ||||||
Transcript | Y74C9A.2a.3 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y74C9A.2a.3:c.50-192_103del | |||||||
cDNA_position | ?-193 | |||||||
CDS_position | ?-103 | |||||||
Protein_position | ?-35 | |||||||
Intron_number | 3/5 | |||||||
Exon_number | 4/6 | |||||||
Y74C9A.2a.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y74C9A.2a.1:c.50-192_103del | |||||||
cDNA_position | ?-193 | |||||||
CDS_position | ?-103 | |||||||
Protein_position | ?-35 | |||||||
Intron_number | 3/5 | |||||||
Exon_number | 4/6 | |||||||
Y74C9A.2a.2 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y74C9A.2a.2:c.50-192_103del | |||||||
cDNA_position | ?-126 | |||||||
CDS_position | ?-103 | |||||||
Protein_position | ?-35 | |||||||
Intron_number | 2/4 | |||||||
Exon_number | 3/5 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. M. Nonet: Gro. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000204 | Paper_evidence | WBPaper00042242 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutant shows mild defects in aBoc steps. | Paper_evidence | WBPaper00042242 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000205 | Paper_evidence | WBPaper00042242 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | Mutant shows a nearly complete loss of the expulsion of gut contents (Exp). Measured as Exp per cycle (Exp frequency). | Paper_evidence | WBPaper00042242 | |||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00064204 | ||||||
Curator_confirmed | WBPerson7196 | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000996 | Paper_evidence | WBPaper00042242 | ||||||
Curator_confirmed | WBPerson590 | |||||||
Phenotype_not_observed | WBPhenotype:0000157 | Paper_evidence | WBPaper00042242 | |||||
Curator_confirmed | WBPerson557 | |||||||
Reference | WBPaper00042242 | |||||||
WBPaper00065757 | ||||||||
WBPaper00064204 | ||||||||
Remark | 14698/14699-14944/14945 (246 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |