WormBase Tree Display for Variation: WBVar00252673
expand all nodes | collapse all nodes | view schema
WBVar00252673 | Name | Public_name | tm4144 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_IV:g.9680302_9680803del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1251 | ||||
Flanking_sequences | taacactatttctttgaatatcttccttga | tataagtctttttatgcttaaaaagtgaga | ||||||
Mapping_target | ZK1251 | |||||||
Source_location | 7 | CHROMOSOME_IV | 9680301 | 9680804 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm4144_external | |||||||
tm4144_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 4144 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002091 | ||||||
Transcript | ZK1251.11a.1 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 2/3 | |||||||
Exon_number | 1-4/4 | |||||||
Interactor (42) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | IV | ||||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00042184 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We examined endogenous ins-7 expression in an ins-8 mutant and vice versa and found that while loss of ins-8 did not result in a change in ins-7 expression, loss of ins-7 resulted in a ~15-fold increase in ins-8 expression (Fig 6C)." | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000012 | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We found that neither deletions in 12 insulins nor knockdown of any of the 40 insulins results in dauers (Fig 1A; Supplemental Table S2)." | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000013 | Paper_evidence | WBPaper00042184 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "After dauer-inducing conditions, all mutants analyzed were capable of forming dauers, indicating that they are not dauer defective (Fig 1B). " | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000039 | Paper_evidence | WBPaper00042184 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure S7 | Paper_evidence | WBPaper00042184 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00042184 | |||||||
Remark | 9071/9072-9573/9574 (502 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |