WormBase Tree Display for Variation: WBVar00252731

WBVar00252731 Name: Public_name: tm4214
    Other_name: C04E6.11b.1:c.187_837delinsTTCTA
      CE36911:p.Ala63PhefsTer46
      C04E6.11a.1:c.187_834delinsTTCTA
      CE07916:p.Ala63PhefsTer46
    HGVSg: CHROMOSOME_V:g.5916723_5917536delinsTAGAA
  Sequence_details: SMap: S_parent: Sequence: C04E6
    Flanking_sequences: tccaataacgctttttcgtagaacttgtcg cctgttctaaaaactgctaaaatgaaacca
    Mapping_target: C04E6
    Source_location: 7 CHROMOSOME_V 5916722 5917537 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: TAGAA
      Deletion
    PCR_product: tm4214_external
      tm4214_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4214
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015425
    Transcript: C04E6.11a.1 (11)
      C04E6.11b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 33845/33846-TAGAA-34659/34660 (814 bp deletion + 5 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele