WormBase Tree Display for Variation: WBVar00252755

WBVar00252755 Name: Public_name: tm4238
    Other_name: CE40321:p.His193ProfsTer2
      ZC123.4c.1:c.108_310del
      ZC123.4b.1:c.324_526del
      CE17302:p.His37ProfsTer2
      ZC123.4a.1:c.576_778del
      CE54328:p.His109ProfsTer2
    HGVSg: CHROMOSOME_I:g.843942_844192del
  Sequence_details: SMap: S_parent: Sequence: ZC123
    Flanking_sequences: ggaggtttctgagaagcgaggcttcacgga gctgatcgtggtcgacgtcttcgaagatgt
    Mapping_target: ZC123
    Source_location: 7 CHROMOSOME_I 843941 844193 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4238_external
      tm4238_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4238
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022519
    Transcript: ZC123.4c.1 (11)
      ZC123.4a.1 (11)
      ZC123.4b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0001911 Paper_evidence: WBPaper00061837
        Curator_confirmed: WBPerson1068
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00061837
  Remark: 40543/40544-40794/40795 (251 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele