WormBase Tree Display for Variation: WBVar00252760

WBVar00252760 Name: Public_name: tm4245
    Other_name: C10G8.6.1:c.127-207_298delinsA
    HGVSg: CHROMOSOME_V:g.5317386_5317764delinsT
  Sequence_details: SMap: S_parent: Sequence: C10G8
    Flanking_sequences: tccttccgatactcacctctttataatgtg ataaattaaagtttacaaatagtttgaagc
    Mapping_target: C10G8
    Source_location: 7 CHROMOSOME_V 5317385 5317765 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: T
      Deletion
    PCR_product: tm4245_external
      tm4245_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4245
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000455
    Transcript: C10G8.6.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C10G8.6.1:c.127-207_298delinsA
        cDNA_position: ?-439
        CDS_position: ?-298
        Protein_position: ?-100
        Intron_number: 3/7
        Exon_number: 4/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 13768/13769-T-14147/14148 (379 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele