WormBase Tree Display for Variation: WBVar00252763
expand all nodes | collapse all nodes | view schema
WBVar00252763 | Name | Public_name | tm4248 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | K02F3.4.1:c.433_646+8del | ||||||||
K02F3.4.3:c.433_646+8del | |||||||||
K02F3.4.2:c.433_646+8del | |||||||||
HGVSg | CHROMOSOME_III:g.835000_835221del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K02F3 | |||||
Flanking_sequences | gcattcgatttcccaccggttccagaagcc | aagacagtatcacactaattaggaaaatcc | |||||||
Mapping_target | K02F3 | ||||||||
Source_location | 7 | CHROMOSOME_III | 834999 | 835222 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Deletion | ||||||||
PCR_product | tm4248_external | ||||||||
tm4248_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 4248 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00305499 | |||||||
WBGene00019327 | |||||||||
Transcript | K02F3.16 | ||||||||
K02F3.4.3 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K02F3.4.3:c.433_646+8del | ||||||||
cDNA_position | 755-? | ||||||||
CDS_position | 433-? | ||||||||
Protein_position | 145-? | ||||||||
Intron_number | 6/7 | ||||||||
Exon_number | 6/8 | ||||||||
K02F3.4.2 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K02F3.4.2:c.433_646+8del | ||||||||
cDNA_position | 588-? | ||||||||
CDS_position | 433-? | ||||||||
Protein_position | 145-? | ||||||||
Intron_number | 4/5 | ||||||||
Exon_number | 4/6 | ||||||||
K02F3.4.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | K02F3.4.1:c.433_646+8del | ||||||||
cDNA_position | 675-? | ||||||||
CDS_position | 433-? | ||||||||
Protein_position | 145-? | ||||||||
Intron_number | 5/6 | ||||||||
Exon_number | 5/7 | ||||||||
Interactor | WBInteraction000524506 | ||||||||
WBInteraction000537379 | |||||||||
WBInteraction000537396 | |||||||||
WBInteraction000537424 | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | III | |||||||
Description | Phenotype | WBPhenotype:0001013 | Paper_evidence | WBPaper00045829 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast, zip-2(tm4248) modestly reduced the enhanced resistance conferred by spg-7(RNAi) (Fig. 4e), consistent with atfs-1 functioning in the same pathway as zip-2 during mitochondrial stress." | Paper_evidence | WBPaper00045829 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | spg-7(RNAi) | Paper_evidence | WBPaper00045829 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001278 | Paper_evidence | WBPaper00045829 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Mitochondrial stress also caused irg-1pr::gfp (pr, promoter) induction, which was blocked in atfs-1(tm4919) and partially so in zip-2(tm4248) worms (Fig. 1k), suggesting that multiple transcription factors and stressors influence innate immune gene expression." | Paper_evidence | WBPaper00045829 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
zip-2(tm4248) suppressed Pseudomonas aeruginosa infection-induced expression of irg-1p::GFP (Figure 2i) | Paper_evidence | WBPaper00045829 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | GO_term | GO:0034514 | PATO:0000460 | Paper_evidence | WBPaper00045829 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO:0045087 | PATO:0000460 | Paper_evidence | WBPaper00045829 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | irg-1p::gfp; spg-7(RNAi) | Paper_evidence | WBPaper00045829 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
irg-1p::gfp | Paper_evidence | WBPaper00045829 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. J. Kaplan: non-Sma. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. J. Kaplan: non-Dpy. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson7743 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Comment to the National Bioresource Project of Japan from Dr. J. Kaplan: non-Egl. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00045829 | ||||||||
Remark | 12299/12300-12521/12522 (222 bp deletion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |