WormBase Tree Display for Variation: WBVar00252764

WBVar00252764 Name: Public_name: tm4249
    Other_name: CE31809:p.Ile73_Ter171delextTer?
      F53A2.6b.1:c.217_513del
      CE16098:p.Ile92_Ter190delextTer?
      F53A2.6a.1:c.274_570del
    HGVSg: CHROMOSOME_III:g.13344042_13344384del
  Sequence_details: SMap: S_parent: Sequence: F53A2
    Flanking_sequences: ttgtgcgattacaacgttttccgtgacgat ccactgttcgatgtgatccgctacgaagat
    Mapping_target: F53A2
    Source_location: 7 CHROMOSOME_III 13344041 13344385 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4249_external
      tm4249_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4249
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002059
    Transcript: F53A2.6b.1 (11)
      F53A2.6a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 25929/25930-26272/26273 (343 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele