WormBase Tree Display for Variation: WBVar00252778

WBVar00252778 Name: Public_name: tm4263
    Other_name: CE52617:p.Arg4_Ter406delextTer?
      CE01473:p.Arg4_Ter406delextTer?
      C08B11.3a.1:c.10_1218del
      C08B11.3b.1:c.10_1218del
    HGVSg: CHROMOSOME_II:g.8026427_8027733del
  Sequence_details: SMap: S_parent: Sequence: C08B11
    Flanking_sequences: aaaaatgtgagcaattgttgcagagttgag actctccattttcaagtgtggttctgaaaa
    Mapping_target: C08B11
    Source_location: 7 CHROMOSOME_II 8026426 8027734 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4263_external
      tm4263_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031322
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4263
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007433
      WBGene00305258
    Transcript: C08B11.3b.1 (11)
      C08B11.14
      C08B11.3a.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 10304/10305-11611/11612 (1307 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele