WormBase Tree Display for Variation: WBVar00252845

WBVar00252845 Name: Public_name: tm4342
    Other_name: Y50E8A.7.1:c.178+15_399del
    HGVSg: CHROMOSOME_V:g.14747771_14748070del
  Sequence_details: SMap: S_parent: Sequence: Y50E8A
    Flanking_sequences: acggagatcataatgagaatgctcgtataa aaaataaaatctaccatctcttccaactgg
    Mapping_target: Y50E8A
    Source_location: 7 CHROMOSOME_V 14747770 14748071 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4342_external
      tm4342_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4342
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00013050
    Transcript: Y50E8A.7.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y50E8A.7.1:c.178+15_399del
        cDNA_position: ?-402
        CDS_position: ?-399
        Protein_position: ?-133
        Intron_number: 3-4/7
        Exon_number: 4-5/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 22786/22787-23086/23087 (300 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele