WormBase Tree Display for Variation: WBVar00252874

WBVar00252874 Name: Public_name: tm4376
    HGVSg: CHROMOSOME_I:g.10016755_10017118delinsAA
  Sequence_details: SMap: S_parent: Sequence: C03C11
    Flanking_sequences: ttgttttattgtttaatttgtatctctcac tgatgttctgcgtctacttccaagtttgta
    Mapping_target: C03C11
    Source_location: 7 CHROMOSOME_I 10016754 10017119 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: AA
      Deletion
    PCR_product: tm4376_external
      tm4376_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4376
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001483
    Transcript: C03C11.2.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-246
        CDS_position: ?-233
        Protein_position: ?-78
        Intron_number: 2-3/9
        Exon_number: 1-4/10
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 17437/17438-AA-17801/17802 (364 bp deletion + 2 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele