WormBase Tree Display for Variation: WBVar00252875

WBVar00252875 Name: Public_name: tm4378
    Other_name: F29F11.6.1:c.419-251_475del
    HGVSg: CHROMOSOME_V:g.10683995_10684302del
  Sequence_details: SMap: S_parent: Sequence: F29F11
    Flanking_sequences: ttaaaaaaggaaaattatgtcaattatttt ttccaattgctgcactcattgatgagaaga
    Mapping_target: F29F11
    Source_location: 7 CHROMOSOME_V 10683994 10684303 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4378_external
      tm4378_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4378
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00001747
    Transcript: F29F11.6.1 VEP_consequence: splice_acceptor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: F29F11.6.1:c.419-251_475del
        cDNA_position: ?-582
        CDS_position: ?-475
        Protein_position: ?-159
        Intron_number: 4/6
        Exon_number: 5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 28845/28846-29153/29154 (308 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele