WormBase Tree Display for Variation: WBVar00252930

WBVar00252930 Name: Public_name: tm4457
    Other_name (13)
    HGVSg: CHROMOSOME_III:g.6634430_6634827del
  Sequence_details: SMap: S_parent: Sequence: C13B9
    Flanking_sequences: tgtctgaaaatattttggctcaagagctca acctggcaaaatttagtcttgccattcttc
    Mapping_target: C13B9
    Source_location: 7 CHROMOSOME_III 6634429 6634828 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4457_external
      tm4457_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4457
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00015735
    Transcript (13)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: III
  Description: Phenotype: WBPhenotype:0000551 Paper_evidence: WBPaper00041718
        Curator_confirmed: WBPerson712
        Remark: pdfr-1 mutants produced an increase in the frequency of high-angle turns (omega turns) compared with wild-type males. Paper_evidence: WBPaper00041718
            Curator_confirmed: WBPerson712
      WBPhenotype:0001482 Paper_evidence: WBPaper00041718
        Curator_confirmed: WBPerson712
        Remark: pdfr-1 mutant males displayed a decrease in the frequency of body bends (propagation of the sinusoidal wave). Paper_evidence: WBPaper00041718
            Curator_confirmed: WBPerson712
      WBPhenotype:0001506 Paper_evidence: WBPaper00041718
        Curator_confirmed: WBPerson712
        Remark: pdfr-1 mutants produced an increase in the frequency of reversals compared with wild-type males. Paper_evidence: WBPaper00041718
            Curator_confirmed: WBPerson712
      WBPhenotype:0002128 Paper_evidence: WBPaper00041718
        Curator_confirmed: WBPerson712
        Remark: Mutant males remain on food in the absence of mates. Males had no drive to explore away from food. Paper_evidence: WBPaper00041718
            Curator_confirmed: WBPerson712
      WBPhenotype:0004004 Paper_evidence: WBPaper00041718
        Curator_confirmed: WBPerson712
        Remark: Mutants were able to successfully mate, although they did not respond as avidly as wild-type males to mate contact. Paper_evidence: WBPaper00041718
            Curator_confirmed: WBPerson712
      WBPhenotype:0004028 Paper_evidence: WBPaper00041718
        Curator_confirmed: WBPerson712
        Remark: pdfr-1 mutant males displayed slow movement on food as a result of a decrease in the frequency of body bends. Paper_evidence: WBPaper00041718
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000643 Paper_evidence: WBPaper00041718
        Curator_confirmed: WBPerson712
        Remark: pdfr-1 mutant males were able to travel the scoring distance of the leaving assay plate (3.5-cm radius) at a rate similar to that of wild-type males if the area was covered with food. Paper_evidence: WBPaper00041718
            Curator_confirmed: WBPerson712
  Reference: WBPaper00041718
  Remark: 15159/15160-15557/15558 (398 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele