WormBase Tree Display for Variation: WBVar00252972

WBVar00252972 Name: Public_name: tm4574
    Other_name: C18E9.6.1:c.156+20_506delinsGTTGAGATGGTATATCAGTATGGAAAG
    HGVSg: CHROMOSOME_II:g.8972879_8973391delinsCTTTCCATACTGATATACCATCTCAAC
  Sequence_details: SMap: S_parent: Sequence: C18E9
    Flanking_sequences: aatattctttccatactgatataccatctc tgaactaagaacatgttacctggaagtgcg
    Mapping_target: C18E9
    Source_location: 7 CHROMOSOME_II 8972877 8973392 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ACTTTCCATACTGATATACCATCTCAAC
      Deletion
    PCR_product: tm4574_external
      tm4574_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4574
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007686
    Transcript: C18E9.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C18E9.6.1:c.156+20_506delinsGTTGAGATGGTATATCAGTATGGAAAG
        cDNA_position: ?-507
        CDS_position: ?-507
        Protein_position: ?-169
        Intron_number: 1-4/7
        Exon_number: 2-5/8
    Interactor: WBInteraction000504747
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000059 Paper_evidence: WBPaper00038075
        Curator_confirmed: WBPerson2987
        Remark: "The strain was outcrossed five times and maintained as a heterozygote over a balancer chromosome since tomm-40 ( tm4574 ) homozygotes arrested as larvae . Using the number of somatic gonadal cells as a criterion for age , 77% of the arrested larvae were found to be L2 larvae , 16% were L3 larvae and 7% were L1 larvae ( n = 43 ) ( Figure 3F ) . All the progeny from tomm-40 ( tm4574 ) / balancer mothers that grew to adulthood , and were not balancer / balancer homozygotes , were heterozygous for tm4574 ( n = 106 ) . No embryonic lethality was detected among the progeny of the heterozygous strain and the number of arrested larvae segregating from a heterozygote was equal to the number of balancer homozygotes . All arrested larvae that were genotyped by PCR were homozygous for the deletion allele . Taking these observations together , we conclude that tomm- 40 ( tm4574 ) homozygotes display a strict larval arrest ." Paper_evidence: WBPaper00038075
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0001236 Paper_evidence: WBPaper00038075
        Curator_confirmed: WBPerson2987
        Remark: "Consistent with the RNAi results , the Phsp-6 : : gfp transgene was also greatly upregulated in tomm-40 ( tm4574 ) deletion mutants ( Figure S3 ) . Paper_evidence: WBPaper00038075
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: Phsp-6 : : gfp Paper_evidence: WBPaper00038075
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001261 Paper_evidence: WBPaper00038075
        Curator_confirmed: WBPerson2987
        Remark: "Examination of the mutant larvae by high power microscopy showed no visible morphological abnormalities, except for a pale appearance . Paper_evidence: WBPaper00038075
            Curator_confirmed: WBPerson2987
    Phenotype_not_observed: WBPhenotype:0000050 Paper_evidence: WBPaper00038075
        Curator_confirmed: WBPerson2987
        Remark: "The strain was outcrossed five times and maintained as a heterozygote over a balancer chromosome since tomm-40 ( tm4574 ) homozygotes arrested as larvae . Using the number of somatic gonadal cells as a criterion for age , 77% of the arrested larvae were found to be L2 larvae , 16% were L3 larvae and 7% were L1 larvae ( n = 43 ) ( Figure 3F ) . All the progeny from tomm-40 ( tm4574 ) / balancer mothers that grew to adulthood , and were not balancer / balancer homozygotes , were heterozygous for tm4574 ( n = 106 ) . No embryonic lethality was detected among the progeny of the heterozygous strain and the number of arrested larvae segregating from a heterozygote was equal to the number of balancer homozygotes . All arrested larvae that were genotyped by PCR were homozygous for the deletion allele . Taking these observations together , we conclude that tomm- 40 ( tm4574 ) homozygotes display a strict larval arrest ." Paper_evidence: WBPaper00038075
            Curator_confirmed: WBPerson2987
      WBPhenotype:0000520 Paper_evidence: WBPaper00038075
        Curator_confirmed: WBPerson2987
        Remark: "Examination of the mutant larvae by high power microscopy showed no visible morphological abnormalities, except for a pale appearance . Paper_evidence: WBPaper00038075
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00038075
  Remark: 12593/12594-ACTTTCCATACTGATATACCATCTCAAC-13107/13108 (514 bp deletion + 28 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele