WormBase Tree Display for Variation: WBVar00253005

WBVar00253005 Name: Public_name: tm4617
    Other_name: K02B12.1.1:c.398_630-17del
    HGVSg: CHROMOSOME_I:g.8499429_8499864del
  Sequence_details: SMap: S_parent: Sequence: K02B12
    Flanking_sequences: ctgcttgtgtgtatctggaaattgaagaac ttgtaaccacagacgtttgattgattattg
    Mapping_target: K02B12
    Source_location: 7 CHROMOSOME_I 8499428 8499865 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4617_external
      tm4617_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4617
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00000431
    Transcript: K02B12.1.1 VEP_consequence: splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K02B12.1.1:c.398_630-17del
        cDNA_position: 742-?
        CDS_position: 398-?
        Protein_position: 133-?
        Intron_number: 3/7
        Exon_number: 3/8
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 6369/6370-6805/6806 (436 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele