WormBase Tree Display for Variation: WBVar00253025

WBVar00253025 Name: Public_name: tm4649
    Other_name: W02D3.9.1:c.599_1556del
      CE14434:p.Arg201IlefsTer17
    HGVSg: CHROMOSOME_I:g.6743325_6744422del
  Sequence_details: SMap: S_parent: Sequence: W02D3
    Flanking_sequences: gttgttgacagaacctcgacataattattc catttttattagctgcgcctccatttgatg
    Mapping_target: W02D3
    Source_location: 7 CHROMOSOME_I 6743324 6744423 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm4649_external
      tm4649_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 4649
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006773
    Transcript: W02D3.9.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson2021
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson2021
  Remark: 23772/23773-24870/24871 (1098 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele