WormBase Tree Display for Variation: WBVar00253063
expand all nodes | collapse all nodes | view schema
| WBVar00253063 | Evidence | Paper_evidence | WBPaper00003989 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | tn471 | |||||
| Other_name | CE32676:p.Gln476Ter | ||||||
| F54C8.3.1:c.1426C>T | |||||||
| HGVSg | CHROMOSOME_III:g.9438211G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | F54C8 | |||
| Flanking_sequences | cttgatatgaaaactcgtcatcttggaatt | aatgcttgactatgatgtaagaaatctgac | |||||
| Mapping_target | F54C8 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003989 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | DG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001284 | |||||
| Transcript | F54C8.3.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F54C8.3.1:c.1426C>T | ||||||
| HGVSp | CE32676:p.Gln476Ter | ||||||
| cDNA_position | 1428 | ||||||
| CDS_position | 1426 | ||||||
| Protein_position | 476 | ||||||
| Exon_number | 8/17 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00003989 | |||
| Genetics | Interpolated_map_position | III | 0.508193 | ||||
| Description | Phenotype | WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||
| Curator_confirmed | WBPerson1250 | ||||||
| Remark | zygotic sterile | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson1250 | ||||||
| WBPhenotype:0001497 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson1250 | ||||||
| Remark | Germline and somatic metaphase to anaphase transition defects. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson1250 | ||||||
| Reference | WBPaper00003989 | ||||||
| Method | Substitution_allele |
