WormBase Tree Display for Variation: WBVar00253071
expand all nodes | collapse all nodes | view schema
| WBVar00253071 | Name | Public_name | tn479 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | CE32676:p.Gly224Asp | ||||||
| F54C8.3.1:c.671G>A | |||||||
| HGVSg | CHROMOSOME_III:g.9439383C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F54C8 | |||
| Flanking_sequences | tggattcgaagattattgtacttgttgctg | tgtgttcccatatatggaaattgatatcag | |||||
| Mapping_target | F54C8 | ||||||
| Type_of_mutation | Substitution | g | a | ||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | DG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001284 | |||||
| Transcript | F54C8.3.1 (12) | ||||||
| Genetics | Interpolated_map_position | III | 0.509889 | ||||
| Description | Phenotype | WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Comments from the National Bioresource Project of Japan: zygotic sterile; early stop codons in several alleles and thus likely to be the null phenotype. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001497 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Comments from the National Bioresource Project of Japan: germline and somatic metaphase to anaphase transition defects; early stop codons in several alleles and thus likely to be the null phenotype. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Method | Substitution_allele |
