WormBase Tree Display for Variation: WBVar00253073
expand all nodes | collapse all nodes | view schema
WBVar00253073 | Evidence | Paper_evidence | WBPaper00003989 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | tn481 | |||||
Other_name | CE32676:p.Leu46Trp | ||||||
F54C8.3.1:c.137T>G | |||||||
HGVSg | CHROMOSOME_III:g.9441322A>C | ||||||
Sequence_details | SMap | S_parent | Sequence | F54C8 | |||
Flanking_sequences | ctcttggatcgaaaactggcgaaatattgt | gaaaagaacatcatggaaaatgatttggaa | |||||
Mapping_target | F54C8 | ||||||
Type_of_mutation | Substitution | t | g | Paper_evidence | WBPaper00003989 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | DG | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001284 | |||||
Transcript | F54C8.3.1 (12) | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00003989 | |||
Genetics | Interpolated_map_position | III | 0.511448 | ||||
Description | Phenotype | WBPhenotype:0000688 | Person_evidence | WBPerson7743 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Comment from the National Bioresource Project of Japan: Class IV A; viable; some sterility; fails to complement tn377ts for Mel and Glp phenotypes at 250C. | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | Comment from the National Bioresource Project of Japan: Class IV A; viable; some sterility; fails to complement tn377ts for Mel and Glp phenotypes at 250C. | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00003989 | ||||||
Method | Substitution_allele |