WormBase Tree Display for Variation: WBVar00253074
expand all nodes | collapse all nodes | view schema
| WBVar00253074 | Evidence | Paper_evidence | WBPaper00003989 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | tn493 | |||||
| Other_name | F54C8.3.1:c.333-1G>A | ||||||
| HGVSg | CHROMOSOME_III:g.9441038C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F54C8 | |||
| Flanking_sequences | ataatagttcgaaatatctattgaaattca | agctgcatccgaaaaaatcgccaaactcca | |||||
| Mapping_target | F54C8 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003989 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | DG | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00001284 | |||||
| Transcript | F54C8.3.1 | VEP_consequence | splice_acceptor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F54C8.3.1:c.333-1G>A | ||||||
| Intron_number | 3/16 | ||||||
| Isolation | Mutagen | EMS | Paper_evidence | WBPaper00003989 | |||
| Genetics | Interpolated_map_position | III | 0.511219 | ||||
| Description | Phenotype | WBPhenotype:0000688 | Paper_evidence | WBPaper00003989 | |||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | zygotic sterile | Paper_evidence | WBPaper00003989 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| WBPhenotype:0001497 | Paper_evidence | WBPaper00003989 | |||||
| Curator_confirmed | WBPerson48 | ||||||
| Remark | Germline and somatic metaphase to anaphase transition defects. | Paper_evidence | WBPaper00003989 | ||||
| Curator_confirmed | WBPerson48 | ||||||
| Reference | WBPaper00003989 | ||||||
| Method | Substitution_allele |
