WormBase Tree Display for Variation: WBVar00253110
expand all nodes | collapse all nodes | view schema
WBVar00253110 | Evidence | Paper_evidence | WBPaper00032907 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | tr116 | ||||||
Other_name | CE31351:p.Arg420Ter | |||||||
F56A11.1.1:c.1258C>T | ||||||||
HGVSg | CHROMOSOME_IV:g.577784C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F56A11 | ||||
Flanking_sequences | gcttttgaacccgacgaatcccaaagataat | gagaatgtcctgaaaatgcggaagagtatga | ||||||
Mapping_target | F56A11 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00032907 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | RP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001579 | ||||||
Transcript | F56A11.1.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | F56A11.1.1:c.1258C>T | |||||||
HGVSp | CE31351:p.Arg420Ter | |||||||
cDNA_position | 1265 | |||||||
CDS_position | 1258 | |||||||
Protein_position | 420 | |||||||
Exon_number | 9/14 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | IV | -24.7798 | |||||
Description | Phenotype | WBPhenotype:0000688 | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000697 | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were isolated based on altered or fewer muscle arms, observed by an altered pattern of trIs25 reporter expression, which expresses membrane-anchored YFP in select muscles of only the distal row of body wall muscles. | Paper_evidence | WBPaper00032907 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | RP112 | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032907 | |||||||
Method | Substitution_allele |