WormBase Tree Display for Variation: WBVar00253111
expand all nodes | collapse all nodes | view schema
WBVar00253111 | Evidence | Paper_evidence | WBPaper00032907 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | tr117 | ||||||
Other_name | F55C7.7i.1:c.4003G>A | |||||||
CE36937:p.Glu1335Lys | ||||||||
F55C7.7i.2:c.4003G>A | ||||||||
CE19465:p.Glu1335Lys | ||||||||
F55C7.7b.1:c.4003G>A | ||||||||
CE19464:p.Glu1335Lys | ||||||||
F55C7.7a.1:c.4003G>A | ||||||||
HGVSg | CHROMOSOME_I:g.4022142C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F55C7 | ||||
Flanking_sequences | ccgagaacgacacggattggagatcaataac | agattgcgagtctcttgataaagcctgttca | ||||||
Mapping_target | F55C7 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00032907 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | RP | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006805 | ||||||
Transcript | F55C7.7i.1 (12) | |||||||
F55C7.7b.1 (12) | ||||||||
F55C7.7a.1 (12) | ||||||||
F55C7.7i.2 (12) | ||||||||
Isolation | Mutagen | EMS | ||||||
Genetics | Interpolated_map_position | I | -1.85849 | |||||
Description | Phenotype | WBPhenotype:0000324 | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001226 | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit commissural axon guidance defects. | Paper_evidence | WBPaper00032907 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001930 | Paper_evidence | WBPaper00032907 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were isolated based on altered or fewer muscle arms, observed by an altered pattern of trIs25 reporter expression, which expresses membrane-anchored YFP in select muscles of only the distal row of body wall muscles. This defect can be rescued by muscle-expressed UNC-73, but not by neuronal-expressed UNC-73. Mutants exhibit non-allelic non-complementation with unc-40(n234) and unc-40(tr121). | Paper_evidence | WBPaper00032907 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | RP112 | Paper_evidence | WBPaper00032907 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00032907 | |||||||
Method | Substitution_allele |