WormBase Tree Display for Variation: WBVar00254893
expand all nodes | collapse all nodes | view schema
WBVar00254893 | Name | Public_name | ttTi5605 | ||||
---|---|---|---|---|---|---|---|
Other_name | attTi5605 | Paper_evidence | WBPaper00046821 | ||||
Remark | Insertion incorrectly cited as attTi5505 | ||||||
Sequence_details | SMap | S_parent | Sequence | F14E5 | |||
Flanking_sequences | ATTCCATGATGGTAGCAAACTCACTTCGTG | TAAGTGCAAGTAAGATCAGTGTTTGTTTCG | |||||
Mapping_target | F14E5 | ||||||
Type_of_mutation | Insertion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Transposon_insertion | Mos | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (13) | |||||||
Laboratory | IE | ||||||
Person | WBPerson6564 | ||||||
DB_info | Database | NemaGENETAG_Consortium | allele_name | ttTi5605 | |||
NemaGENETAG_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00195147 | |||||
Transcript | F14E5.8.1 | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000886 | Paper_evidence | WBPaper00032302 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | ttTi5605 is an insertion of the Mos1 element in a noncoding region. | Paper_evidence | WBPaper00032302 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040752 | ||||||
WBPaper00032302 | |||||||
WBPaper00028894 | |||||||
WBPaper00033043 | |||||||
Remark | [20060613 ls] the TA insertion site may be +/- 10bp from this location | ||||||
[20060613 ls] the left side of Mos is facing the left of the sequence (to be confirmed). | |||||||
[20060613 ls] this MOS insertion generated thanks to a grant of the European Union (project NEMAGENETAG) | |||||||
For further information and strain requests please visit http://ums3421.univ-lyon1.fr/ | |||||||
Method | NemaGENETAG_consortium_allele |