WormBase Tree Display for Variation: WBVar00266495
expand all nodes | collapse all nodes | view schema
WBVar00266495 | Evidence | Paper_evidence | WBPaper00024641 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | u20 | |||||
Other_name | F16F9.5.1:c.2026G>C | ||||||
CE09444:p.Gly676Arg | |||||||
HGVSg | CHROMOSOME_X:g.8466155C>G | ||||||
Sequence_details | SMap | S_parent | Sequence | F16F9 | |||
Flanking_sequences | tttcagattgtaaaaatgatggctgatttt | gaggacaccttggactttggtcaggagttt | |||||
Mapping_target | F16F9 | ||||||
Type_of_mutation | Substitution | g | m | Paper_evidence | WBPaper00024641 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | TU | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003174 | |||||
Transcript | F16F9.5.1 (12) | ||||||
Genetics | Interpolated_map_position | X | 0.007131 | ||||
Description | Phenotype (20) | ||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040149 | ||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The distribution of the mechanoreceptor channels along the process of PLM touch receptor neurons is essentially unchanged in mec-10 mutants as assayed by the localization pattern of MEC-4::YFP and anti-MEC-2 antibody staining. | Paper_evidence | WBPaper00040149 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040149 | ||||||
WBPaper00043908 | |||||||
WBPaper00025615 | |||||||
WBPaper00026038 | |||||||
Method | Substitution_allele |