WormBase Tree Display for Variation: WBVar00266636
expand all nodes | collapse all nodes | view schema
WBVar00266636 | Evidence | Paper_evidence | WBPaper00030754 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | u280 | ||||||
Other_name (34) | ||||||||
HGVSg | CHROMOSOME_IV:g.12782539C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK897 | ||||
Flanking_sequences | gatgacgaaaatgagcgacatctatgggtc | aggctctgtaccgagccacaggtcaagcct | ||||||
Mapping_target | ZK897 | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00030754 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin (3) | ||||||||
Affects | Gene | WBGene00006767 | ||||||
Transcript (17) | ||||||||
Genetics | Interpolated_map_position | IV | 6.32069 | |||||
Description | Phenotype | WBPhenotype:0000204 | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | aBoc is executed ~50% of the time. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 50 | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Semi_dominant | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000391 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Emc precedes aBoc 75% of the time. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | 75 | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Contains the same amber suppressible mutation as e375 and e69. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001410 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | As determined by a lack of signal on Western blots probed with an antibody corresponding to amino acids 42-304 of UNC-31. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | As assayed by ANF::GFP fluorescence accumulation in coelomocytes | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG3682 unc-31(u280) oxIs206[Paex-3:ANF::GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000604 | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants exhibit the correct specification, number and position of cell bodies of the GABAergic nervous system. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG1846 unc-31(u280); oxIs12[Punc-47:GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000616 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The number of synaptic densities in dorsal nerve cord cholinergic neurons of unc-31 mutants is similar to that in wild-type animals. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Not stated | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | The density and distribution of tagged Synaptobrevin in GABA neurons is normal. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG1485 unc-31(u280) nIs52[Punc-25:SNB-1::GFP;lin-15(+)] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00030754 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No gross defects were observed in the number of GABA commissures or in GABA axon projection. | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00030754 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | EG1846 unc-31(u280); oxIs12[Punc-47:GFP] | Paper_evidence | WBPaper00030754 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00015225 | |||||||
WBPaper00017299 | ||||||||
WBPaper00030754 | ||||||||
WBPaper00048388 | ||||||||
Method | Substitution_allele |