WormBase Tree Display for Variation: WBVar00274950
expand all nodes | collapse all nodes | view schema
WBVar00274950 | Evidence | Paper_evidence | WBPaper00006015 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ut187 | |||||||
Other_name | Y44A6D.4.1:c.791G>A | ||||||||
CE35663:p.Arg264Lys | |||||||||
HGVSg | CHROMOSOME_V:g.20800127G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y44A6D | |||||
Flanking_sequences | aggatctcatcgtgaagtgcaaacacatga | aattcattgcgttccagtggctttgcacca | |||||||
Mapping_target | Y44A6D | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00006015 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022196 | ||||||||
Laboratory | JC | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004748 | |||||||
Transcript | Y44A6D.4.1 (12) | ||||||||
Interactor | WBInteraction000503475 | ||||||||
Genetics | Interpolated_map_position | V | 25.2565 | ||||||
Description | Phenotype | WBPhenotype:0000308 | Paper_evidence | WBPaper00031480 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Weak dauer arrest. | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00031480 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00031480 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | sod-3 mRNA levels are very weakly increased as assayed by real-time reverse transcription. PCR. | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00031480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited life spans similar (12.9 2.0, n=102) to normal animals (12.7 2.1 days, n=101). | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Life span was measured as described in Hu et al. 2006. | Paper_evidence | WBPaper00031480 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00031480 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | DAF-16::GFP is translocated to the cytoplasm as it is in wild-type animals. | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00031480 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000027 | PATO:0000460 | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were scored in late L1/ early L2. | Paper_evidence | WBPaper00031480 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | DAF-16::GFP | Paper_evidence | WBPaper00031480 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031480 | ||||||||
Method | Substitution_allele |