WormBase Tree Display for Variation: WBVar00275093
expand all nodes | collapse all nodes | view schema
WBVar00275093 | Name | Public_name | vs105 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_V:g.9609233_9609313del | |||||||
Sequence_details | SMap | S_parent | Sequence | K09G1 | ||||
Flanking_sequences | taataaaaaagtatattttcttttcaggta | gtggccatcatagttatgccatacgcggtt | ||||||
Mapping_target | K09G1 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (12) | ||||||||
Laboratory | LX | |||||||
CF | ||||||||
IV | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00001053 | ||||||
Transcript (6) | ||||||||
Interactor | WBInteraction000518035 | |||||||
Genetics | Interpolated_map_position | V | 2.05496 | |||||
Description | Phenotype (16) | |||||||
Phenotype_not_observed | WBPhenotype:0001006 | Paper_evidence | WBPaper00044757 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure S2C | Paper_evidence | WBPaper00044757 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00032196 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals were as susceptible to infection by P. aeruginosa as N2 animals. | Paper_evidence | WBPaper00032196 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Strain | WBStrain00026373 | Paper_evidence | WBPaper00032196 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00038382 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | No effects on clozapine-induced egg laying were observed. | Paper_evidence | WBPaper00038382 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003634 | Paper_evidence | WBPaper00038382 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001182 | Paper_evidence | WBPaper00044757 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 2A | Paper_evidence | WBPaper00044757 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001817 | Paper_evidence | WBPaper00032335 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibited enhanced-gustatory plasticity, i.e. strong avoidance to NaCl after starvation, similar to that observed for wild type. | Paper_evidence | WBPaper00032335 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003571 | Paper_evidence | WBPaper00032335 | ||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:0050742 | ||||||
Modifies_disease | DOID:680 | |||||||
Models_disease_in_annotation | WBDOannot00000688 | |||||||
Modifies_disease_in_annotation | WBDOannot00000764 | |||||||
WBDOannot00000766 | ||||||||
WBDOannot00000767 | ||||||||
Reference | WBPaper00038382 | |||||||
WBPaper00041959 | ||||||||
WBPaper00043908 | ||||||||
WBPaper00032196 | ||||||||
WBPaper00032335 | ||||||||
WBPaper00044757 | ||||||||
WBPaper00065340 | ||||||||
WBPaper00065715 | ||||||||
Remark | This deletion removes most of the first and second transmembrane domain and the splice acceptor for exon 2. | Paper_evidence | WBPaper00024390 | |||||
Method | Deletion_allele |