WormBase Tree Display for Variation: WBVar00275097
expand all nodes | collapse all nodes | view schema
WBVar00275097 | Evidence | Paper_evidence | WBPaper00035082 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | vs126 | |||||
Other_name | H16O14.1e.1:c.1529C>T | ||||||
CE44206:p.Pro566Leu | |||||||
H16O14.1a.1:c.1697C>T | |||||||
H16O14.1d.1:c.1901C>T | |||||||
H16O14.1c.1:c.1820C>T | |||||||
H16O14.1b.1:c.1751C>T | |||||||
CE49181:p.Pro510Leu | |||||||
CE44251:p.Pro584Leu | |||||||
CE44232:p.Pro607Leu | |||||||
CE49266:p.Pro634Leu | |||||||
HGVSg | CHROMOSOME_IV:g.6070398C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | H16O14 | |||
Flanking_sequences | cgtgtgcacttcaatcacttctaaaatctc | tggatggcgtccaggattccgttacttcca | |||||
Mapping_target | H16O14 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00035082 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00026381 | ||||||
Laboratory | LX | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00019205 | |||||
Transcript | H16O14.1e.1 (12) | ||||||
H16O14.1d.1 (12) | |||||||
H16O14.1b.1 (12) | |||||||
H16O14.1a.1 (12) | |||||||
H16O14.1c.1 (12) | |||||||
Genetics | Interpolated_map_position | IV | 2.95684 | ||||
Description | Phenotype | WBPhenotype:0000774 | Paper_evidence | WBPaper00035082 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | kcc-2 mutants show a decrease in egg production | Paper_evidence | WBPaper00035082 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035082 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Phenotype_not_observed | WBPhenotype:0000005 | Paper_evidence | WBPaper00035082 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Wild-type and kcc-2 mutants have similar egg-laying rates | Paper_evidence | WBPaper00035082 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035082 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00035082 | ||||||
Method | Substitution_allele |