WormBase Tree Display for Variation: WBVar00275099
expand all nodes | collapse all nodes | view schema
WBVar00275099 | Evidence | Paper_evidence | WBPaper00035082 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | vs132 | |||||||
Other_name | H16O14.1c.1:c.1508_1509delinsAA | ||||||||
H16O14.1e.1:c.1217_1218delinsAA | |||||||||
H16O14.1d.1:c.1589_1590delinsAA | |||||||||
CE44232:p.Trp503Ter | |||||||||
CE44251:p.Trp480Ter | |||||||||
H16O14.1b.1:c.1439_1440delinsAA | |||||||||
CE49181:p.Trp406Ter | |||||||||
H16O14.1a.1:c.1385_1386delinsAA | |||||||||
CE49266:p.Trp530Ter | |||||||||
CE44206:p.Trp462Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.6068853_6068854delinsAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | H16O14 | |||||
Flanking_sequences | atgggaaaattgatcatttcggaaatttcct | ccatttccacaagtaattctttttggatgtt | |||||||
Mapping_target | H16O14 | ||||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00035082 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (11) | |||||||||
Laboratory | LX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00019205 | |||||||
Transcript | H16O14.1e.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | H16O14.1e.1:c.1217_1218delinsAA | ||||||||
HGVSp | CE49181:p.Trp406Ter | ||||||||
cDNA_position | 1217-1218 | ||||||||
CDS_position | 1217-1218 | ||||||||
Protein_position | 406 | ||||||||
Exon_number | 5/12 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
H16O14.1d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | H16O14.1d.1:c.1589_1590delinsAA | ||||||||
HGVSp | CE49266:p.Trp530Ter | ||||||||
cDNA_position | 1589-1590 | ||||||||
CDS_position | 1589-1590 | ||||||||
Protein_position | 530 | ||||||||
Exon_number | 8/15 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
H16O14.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | H16O14.1b.1:c.1439_1440delinsAA | ||||||||
HGVSp | CE44251:p.Trp480Ter | ||||||||
cDNA_position | 1543-1544 | ||||||||
CDS_position | 1439-1440 | ||||||||
Protein_position | 480 | ||||||||
Exon_number | 8/16 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
H16O14.1a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | H16O14.1a.1:c.1385_1386delinsAA | ||||||||
HGVSp | CE44206:p.Trp462Ter | ||||||||
cDNA_position | 1385-1386 | ||||||||
CDS_position | 1385-1386 | ||||||||
Protein_position | 462 | ||||||||
Exon_number | 7/15 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
H16O14.1c.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | H16O14.1c.1:c.1508_1509delinsAA | ||||||||
HGVSp | CE44232:p.Trp503Ter | ||||||||
cDNA_position | 1784-1785 | ||||||||
CDS_position | 1508-1509 | ||||||||
Protein_position | 503 | ||||||||
Exon_number | 8/16 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000501231 | ||||||||
WBInteraction000504780 | |||||||||
WBInteraction000517363 | |||||||||
WBInteraction000517364 | |||||||||
WBInteraction000517365 | |||||||||
Genetics | Interpolated_map_position | IV | 2.95644 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00038249 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit decreased egg production. | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000324 | Paper_evidence | WBPaper00038249 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants were modestly shorter than wild type animals. | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000774 | Paper_evidence | WBPaper00035082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | kcc-2 mutants show a decrease in egg production | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001101 | Paper_evidence | WBPaper00035082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In contrast to the 99% inhibition of egg laying seen in the wild type, muscimol caused only a 14% reduction in the kcc-2 mutant | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001204 | Paper_evidence | WBPaper00035082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants failed to show the rubber-band phenotype when prodded after muscimol treatment unlike wild-type. In kcc-2 mutants, the effect of muscimol was reversed and a significant decrease in body length was observed | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00038249 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | We observed that abts-1::gfp expression was significantly increased in the HSNs of kcc-2 mutants (Figure 7G, H, and L). There was a 2.3-fold increase in GFP fluorescence in the HSNs of kcc-2 mutants as compared with wild-type animals. | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001628 | Paper_evidence | WBPaper00035082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | kcc-2 mutants are resistant to the paralysis induced by serotonin treatment | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001670 | Paper_evidence | WBPaper00035082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There was a significant decrease in the size of the synaptic vesicle population within HSN presynaptic termini of kcc-2 mutants. The total amount of SNB-1::GFP fluorescence in the synaptic region of the kcc-2 mutant was 28.6% less than in the wildtype | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002047 | Paper_evidence | WBPaper00038249 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants show excitatory rather than inhibitory responses to the GABA A agonist muscimol. | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003906 | Paper_evidence | WBPaper00038249 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002071 | Paper_evidence | WBPaper00038249 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants exposed to muscimol undergo a decrease in body length, whereas wild-type animals exposed to muscimol experience a significant increase in body length. | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003906 | Paper_evidence | WBPaper00038249 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000005 | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Wild-type and kcc-2 mutants have similar egg-laying rates | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000180 | Paper_evidence | WBPaper00035082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSN process morphology was not altered in kcc-2 mutants. The total volume of the varicosities was not altered in the kcc-2 mutant compared with the wild-type | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00035082 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000546 | Paper_evidence | WBPaper00038249 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00038249 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | These mutants show well-coordinated locomotion. | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00035082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | An analysis of GFP::SYD-2 to visualize active zones in the HSNs of wild-type and kcc-2 mutants showed no detectable difference in this active zone marker | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00035082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001703 | Paper_evidence | WBPaper00038249 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Wild-type animals and kcc-2 mutants performed a similar number of coordinated body bends. | Paper_evidence | WBPaper00038249 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038249 | ||||||||
WBPaper00035082 | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00019205 Amber_UAG_or_Opal_UGA W to stop | Paper_evidence | WBPaper00035082 | ||||||
Method | Substitution_allele |