WormBase Tree Display for Variation: WBVar00275113
expand all nodes | collapse all nodes | view schema
| WBVar00275113 | Evidence | Paper_evidence | WBPaper00004781 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | w34 | |||||||
| Other_name | C18D1.1a.1:c.424C>T | ||||||||
| C18D1.1b.1:c.352C>T | |||||||||
| CE51425:p.Gln118Ter | |||||||||
| CE51263:p.Gln142Ter | |||||||||
| HGVSg | CHROMOSOME_II:g.10063784G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C18D1 | |||||
| Flanking_sequences | caatttcaggttgatcaggagccagaagaa | aacgagaatcctctccaagcccaccaccag | |||||||
| Mapping_target | C18D1 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00004781 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00022754 | ||||||||
| Laboratory | JR | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00000995 | |||||||
| Transcript | C18D1.1a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C18D1.1a.1:c.424C>T | ||||||||
| HGVSp | CE51263:p.Gln142Ter | ||||||||
| cDNA_position | 424 | ||||||||
| CDS_position | 424 | ||||||||
| Protein_position | 142 | ||||||||
| Exon_number | 3/7 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| C18D1.1b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C18D1.1b.1:c.352C>T | ||||||||
| HGVSp | CE51425:p.Gln118Ter | ||||||||
| cDNA_position | 352 | ||||||||
| CDS_position | 352 | ||||||||
| Protein_position | 118 | ||||||||
| Exon_number | 2/5 | ||||||||
| Codon_change | Caa/Taa | ||||||||
| Amino_acid_change | Q/* | ||||||||
| Isolation | Mutagen | EMS | |||||||
| Genetics | Interpolated_map_position | II | 1.87211 | ||||||
| Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00044621 | |||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| WBPhenotype:0001660 | Paper_evidence | WBPaper00044621 | |||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Remark | Loss of ASE asymmetry (Fig 2A) | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005663 | PATO:0000460 | Paper_evidence | WBPaper00044621 | ||||
| Curator_confirmed | WBPerson6538 | ||||||||
| WBPhenotype:0001661 | Paper_evidence | WBPaper00044621 | |||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Remark | Loss of AWC asymmetry (Fig 5) | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00044621 | ||||||
| Curator_confirmed | WBPerson6538 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005672 | PATO:0000460 | Paper_evidence | WBPaper00044621 | ||||
| Curator_confirmed | WBPerson6538 | ||||||||
| Reference | WBPaper00004781 | ||||||||
| WBPaper00044621 | |||||||||
| Method | Substitution_allele |
