WormBase Tree Display for Variation: WBVar00275120
expand all nodes | collapse all nodes | view schema
| WBVar00275120 | Evidence | Paper_evidence | WBPaper00005233 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | wa14 | |||||||
| Other_name | T13F2.1b.1:c.28C>T | ||||||||
| T13F2.1a.1:c.301C>T | |||||||||
| CE44752:p.Arg10Ter | |||||||||
| CE25113:p.Arg101Ter | |||||||||
| HGVSg | CHROMOSOME_IV:g.9800322C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | T13F2 | |||||
| Flanking_sequences | aacatgggaactttcaatatttctgagaaa | gatctgcccaaataaataaaagtttcactg | |||||||
| Mapping_target | T13F2 | ||||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005233 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004009 | ||||||||
| WBStrain00004013 | |||||||||
| Laboratory | BX | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001396 | |||||||
| Transcript | T13F2.1a.1 | VEP_consequence | stop_gained | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | T13F2.1a.1:c.301C>T | ||||||||
| HGVSp | CE25113:p.Arg101Ter | ||||||||
| cDNA_position | 343 | ||||||||
| CDS_position | 301 | ||||||||
| Protein_position | 101 | ||||||||
| Exon_number | 4/10 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| T13F2.1b.1 | VEP_consequence | stop_gained | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | T13F2.1b.1:c.28C>T | ||||||||
| HGVSp | CE44752:p.Arg10Ter | ||||||||
| cDNA_position | 28 | ||||||||
| CDS_position | 28 | ||||||||
| Protein_position | 10 | ||||||||
| Exon_number | 1/6 | ||||||||
| Codon_change | Cga/Tga | ||||||||
| Amino_acid_change | R/* | ||||||||
| Genetics | Interpolated_map_position | IV | 4.41967 | ||||||
| Description | Phenotype | WBPhenotype:0000138 | Paper_evidence | WBPaper00005233 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | fat-4 mutants displayed a fatty acid profile with reduced 20:4n6 and 20:5n3 and increased levels of 20:3n6 and 20:4n3 that lack a double bond at the delta-5 position. The original segregating population contained 0.2% 20:4n6 and 12% 20:5n3 as compared with 1.7% 20:4n6 and 17.2% 20:5n3 in WT, and 7% 20:3n6 and 16.5.% 20:4n3 compared with 6% 20:3n6 and 9.8% 20:4n3 in WT. Analysis of progeny from the segregating population again revealed three classes: (i) WT, (ii) the original segregating fatty acid profile, and (iii) a population with no detectable 20:4n6 or 20:5n3 and 8.2% 20:3 and 24.8% 20:4n3 (Fig. 3E, Table 1). | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000520 | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000624 | Paper_evidence | WBPaper00005233 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000643 | Paper_evidence | WBPaper00005233 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000676 | Paper_evidence | WBPaper00005233 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Similar to the fat-1 mutants, fat-4 homozygotes are indistinguishable phenotypically from WT under laboratory conditions ( Fig . 3E ) . | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001823 | Paper_evidence | WBPaper00028527 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Sperm motility defects were not observed | Paper_evidence | WBPaper00028527 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028527 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Wild-type males labelled with MitoTracker were mated to non-labelled mutant hermaphrodites | Paper_evidence | WBPaper00028527 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Disease_info | Models_disease | DOID:1574 | |||||||
| Models_disease_in_annotation | WBDOannot00000698 | ||||||||
| Reference | WBPaper00005233 | ||||||||
| WBPaper00028527 | |||||||||
| WBPaper00060921 | |||||||||
| Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||||
| Created by WBPerson1983 from the NN_VFP_triage_pipeline | |||||||||
| Method | Substitution_allele |
