WormBase Tree Display for Variation: WBVar00275126
expand all nodes | collapse all nodes | view schema
WBVar00275126 | Evidence | Paper_evidence | WBPaper00005233 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | wa23 | |||||
Other_name | CE48384:p.Gly322Arg | ||||||
W08D2.4a.1:c.1267G>A | |||||||
W08D2.4d.1:c.964G>A | |||||||
CE25153:p.Gly423Arg | |||||||
CE45719:p.Gly165Arg | |||||||
W08D2.4c.1:c.169G>A | |||||||
W08D2.4b.1:c.493G>A | |||||||
CE45812:p.Gly57Arg | |||||||
HGVSg | CHROMOSOME_IV:g.9805934G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | W08D2 | |||
Flanking_sequences | cttccttacctcgtcgatgactactttgac | gatatgcaatgaatttgcaacaattgaaaa | |||||
Mapping_target | W08D2 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005233 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | BX | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001395 | |||||
Transcript | W08D2.4d.1 (12) | ||||||
W08D2.4a.1 (12) | |||||||
W08D2.4b.1 (12) | |||||||
W08D2.4c.1 (12) | |||||||
Genetics | Interpolated_map_position | IV | 4.42145 | ||||
Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00005233 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Although fat-3 homozygotes are viable and fertile, they grow slowly, move sluggishly, and have a reduced brood size. In growth comparisons, authors found that after 3 days of growth at 20 degrees Celsius, staged embryos produced by fat-3 homozygous mothers had developed to L4 larval stage, whereas similar stage WT embryos had reached adulthood and were beginning to lay eggs (Fig. 3 A and D). The fat-3 animals required an additional day of development before commencing egg laying. | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000138 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | fat-3 mutants displayed a modest increase in fatty acids 18:2n6 (9.1 vs. 5.4% in WT) and 18:3n3 (2 vs. 0.2% in WT). Homozygotes segregating from this population displayed a striking fatty acid composition, with only 1.0% 20:2n6 and 1.6% 20:3n3 and no other detectable C20 fatty acids (Fig. 3D, Table 1). The 18:2n6 increased to 12.7% and the 18:3n3 accumulated to 11.0%. | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Although fat-3 homozygotes are viable and fertile, they grow slowly, move sluggishly, and have a reduced brood size. | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000646 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Although fat-3 homozygotes are viable and fertile, they grow slowly, move sluggishly, and have a reduced brood size. | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001418 | Paper_evidence | WBPaper00044578 | |||||
Curator_confirmed | WBPerson12259 | ||||||
Remark | Figure 4B | Paper_evidence | WBPaper00044578 | ||||
Curator_confirmed | WBPerson12259 | ||||||
Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | fat-3 homozygotes are viable. | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | fat-3 homozygotes are fertile | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00005233 | ||||||
WBPaper00044578 | |||||||
Method | Substitution_allele |