WormBase Tree Display for Variation: WBVar00275130
expand all nodes | collapse all nodes | view schema
WBVar00275130 | Evidence | Paper_evidence | WBPaper00005233 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | wa31 | |||||
Other_name | CE47981:p.Gly121Glu | ||||||
CE05979:p.Gly175Glu | |||||||
F56H11.4a.1:c.524G>A | |||||||
F56H11.4b.1:c.362G>A | |||||||
HGVSg | CHROMOSOME_IV:g.9527594G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | F56H11 | |||
Flanking_sequences | acgcctggtactctcatccattgaccccag | attcaacagatacggaatttatcttaactt | |||||
Mapping_target | F56H11 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005233 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (3) | |||||||
Affects (2) | |||||||
Genetics | Interpolated_map_position | IV | 4.29167 | ||||
Description | Phenotype | WBPhenotype:0000138 | Paper_evidence | WBPaper00005233 | |||
Curator_confirmed | WBPerson2987 | ||||||
Remark | One class of mutants displayed a 10-fold increase in fatty acid 18:3n6 (8.3% compared with 0.8% in WT). Segregating populations revealed that the homozygotes accumulate 12.4% 18:3n6 as well as 6.3% 18:4n3, a fatty acid normally not detected in WT (Fig. 3F, Table 1). | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Phenotype_not_observed | WBPhenotype:0000031 | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | elo-1 mutants did not exhibit slow growth or movement defects. | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00005233 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | elo-1 mutants did not exhibit slow growth or movement defects. | Paper_evidence | WBPaper00005233 | ||||
Curator_confirmed | WBPerson2987 | ||||||
Reference | WBPaper00005233 | ||||||
Method | Substitution_allele |