WormBase Tree Display for Variation: WBVar00275210
expand all nodes | collapse all nodes | view schema
| WBVar00275210 | Name | Public_name | x15 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | C35C5.5.1:c.56-1G>A | ||||||||
| HGVSg | CHROMOSOME_X:g.11561028G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C35C5 | |||||
| Flanking_sequences | tcaaagcatatgtatgtgtctcttgtttca | atattgtcacaattaatgccaacaaacatg | |||||||
| Mapping_target | C35C5 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00025035 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00040920 | ||||||||
| Laboratory | ZZ | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00002975 | |||||||
| Transcript | C35C5.5.1 | VEP_consequence | splice_acceptor_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | C35C5.5.1:c.56-1G>A | ||||||||
| Intron_number | 2/13 | ||||||||
| Genetics | Interpolated_map_position | X | 4.60492 | ||||||
| Mapping_data | In_2_point | 236 | |||||||
| In_multi_point | 230 | ||||||||
| Description | Phenotype (22) | ||||||||
| Phenotype_not_observed | WBPhenotype:0000643 | Paper_evidence | WBPaper00000484 | ||||||
| WBPaper00041959 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson557 | |||||||||
| Remark | Reasonably wild-type motor behavior on regular growth media. Mutants gain the resistant Unc phenotype when grown on levamisole plates. At 15C, most lev-8 individuals on levamisole plates are still paralyzed the next day and slowly recover over the next few days. | Paper_evidence | WBPaper00000484 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000484 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Temperature_sensitive | Cold_sensitive | 15 | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Temperature | 15, 25 | Paper_evidence | WBPaper00000484 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001468 | Paper_evidence | WBPaper00041959 | |||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Remark | Mutant worms exhibited a normal approach to a benzaldehyde stimulus. | Paper_evidence | WBPaper00041959 | ||||||
| Curator_confirmed | WBPerson557 | ||||||||
| Phenotype_assay | Treatment | Worms placed on chemotaxis plates spotted with 0.01% benzaldehyde. | Paper_evidence | WBPaper00041959 | |||||
| Curator_confirmed | WBPerson557 | ||||||||
| WBPhenotype:0001853 | Paper_evidence | WBPaper00035150 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutant response to AAD 1470 was comparable to that observed in wild-type | Paper_evidence | WBPaper00035150 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00041959 | ||||||||
| WBPaper00043908 | |||||||||
| WBPaper00034730 | |||||||||
| WBPaper00035074 | |||||||||
| WBPaper00035150 | |||||||||
| WBPaper00000484 | |||||||||
| WBPaper00025035 | |||||||||
| WBPaper00025589 | |||||||||
| Method | Substitution_allele |
