WormBase Tree Display for Variation: WBVar00275223
expand all nodes | collapse all nodes | view schema
WBVar00275223 | Evidence | Person_evidence | WBPerson12082 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | x29 | |||||
Other_name | CE13451:p.Tyr449Ter | ||||||
T08G11.5.1:c.1347T>A | |||||||
HGVSg | CHROMOSOME_I:g.8897941A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | T08G11 | |||
Flanking_sequences | tgttcctccaacagttattccaaaaaatac | taaagcagcaatcgatcgattatcattgcc | |||||
Mapping_target | T08G11 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | ZZ | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006765 | |||||
Transcript | T08G11.5.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | T08G11.5.1:c.1347T>A | ||||||
HGVSp | CE13451:p.Tyr449Ter | ||||||
cDNA_position | 1354 | ||||||
CDS_position | 1347 | ||||||
Protein_position | 449 | ||||||
Exon_number | 12/14 | ||||||
Codon_change | taT/taA | ||||||
Amino_acid_change | Y/* | ||||||
Interactor | WBInteraction000504040 | ||||||
WBInteraction000518497 | |||||||
WBInteraction000518498 | |||||||
WBInteraction000518941 | |||||||
Genetics | Interpolated_map_position | I | 3.27957 | ||||
Mapping_data | In_multi_point | 3119 | |||||
Description | Phenotype | WBPhenotype:0000421 | Paper_evidence | WBPaper00035548 | |||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | GFP-OIG-4 protein was undetectable at NMJs in animals that did not express the L-AChR subunit UNC-29. However, GFP-OIG-4 remained expressed at wild-type levels based on western blot analysis and was normally secreted based on GFP detection in coelomocytes. | Paper_evidence | WBPaper00038066 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00035548 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00032995 | |||||
Person_evidence | WBPerson12082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||
WBPerson712 | |||||||
Remark | Mutants display swimming defects | Paper_evidence | WBPaper00032995 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Information submitted by | Curator_confirmed | WBPerson712 | |||||
WBPhenotype:0002132 | Paper_evidence | WBPaper00038066 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | OIG-4 and LEV-10 no longer co-immunoprecipitate in the absence of UNC-29. | Paper_evidence | WBPaper00038066 | ||||
Curator_confirmed | WBPerson712 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00038066 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038066 | ||||||
WBPaper00035548 | |||||||
WBPaper00025762 | |||||||
WBPaper00032995 | |||||||
WBPaper00016088 | |||||||
WBPaper00016188 | |||||||
WBPaper00016087 | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |