WormBase Tree Display for Variation: WBVar00275385
expand all nodes | collapse all nodes | view schema
WBVar00275385 | Evidence | Paper_evidence | WBPaper00028852 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ye4 | ||||||
Other_name | C53B4.7e.1:c.680G>A | |||||||
CE40447:p.Gly215Glu | ||||||||
CE27116:p.Gly217Glu | ||||||||
CE23608:p.Gly201Glu | ||||||||
CE40448:p.Gly227Glu | ||||||||
C53B4.7c.1:c.602G>A | ||||||||
C53B4.7d.1:c.644G>A | ||||||||
C53B4.7b.1:c.695G>A | ||||||||
CE27117:p.Gly232Glu | ||||||||
C53B4.7a.1:c.650G>A | ||||||||
HGVSg | CHROMOSOME_IV:g.8989585G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | C53B4 | ||||
Flanking_sequences | gtgaagcctacaatatgtttgcttgcaatg | aattttgttcaaccatgagagtccaagaag | ||||||
Mapping_target | C53B4 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00028852 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008570 | |||||||
Laboratory | HY | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000266 | ||||||
Transcript | C53B4.7e.1 (12) | |||||||
C53B4.7a.1 (12) | ||||||||
C53B4.7b.1 (12) | ||||||||
C53B4.7d.1 (12) | ||||||||
C53B4.7c.1 (12) | ||||||||
Genetics | Interpolated_map_position | IV | 4.00029 | |||||
Description | Phenotype | WBPhenotype:0000154 | Paper_evidence | WBPaper00028852 | ||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00028852 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have robust but lower than wild-type brood sizes. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001507 | Paper_evidence | WBPaper00028852 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Remark | bre-1(ye4) animals are resistant to Cry5B. | Paper_evidence | WBPaper00028852 | |||||
Curator_confirmed | WBPerson557 | |||||||
Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00028852 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0002035 | Paper_evidence | WBPaper00041118 | ||||||
Curator_confirmed | WBPerson9999 | |||||||
Remark | resistant to Coprinopsis cinerea fruiting body lectin CCL2 | Paper_evidence | WBPaper00041118 | |||||
Curator_confirmed | WBPerson9999 | |||||||
Affected_by | Molecule | WBMol:00007869 | Paper_evidence | WBPaper00041118 | ||||
Curator_confirmed | WBPerson9999 | |||||||
WBPhenotype:0002036 | Paper_evidence | WBPaper00039883 | ||||||
Curator_confirmed | WBPerson9999 | |||||||
Remark | susceptible to fruiting body lectin Marasmius oreades agglutinin (MOA, a Galα1,3Gal/GalNAc-specific lectin). Mutations in bre-3, bre-4 or bre-5 confer resistance | Paper_evidence | WBPaper00039883 | |||||
Curator_confirmed | WBPerson9999 | |||||||
Affected_by | Molecule | WBMol:00007870 | Paper_evidence | WBPaper00039883 | ||||
Curator_confirmed | WBPerson9999 | |||||||
WBPhenotype:0002060 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Produces a brood when grown in the presence of Bt toxin Cry5B. The intestines of mutants fed Bt-produced toxin have intestinal morphology often indistinguishable from that of healthy wild-type intestine not exposed to toxin. Mutants are resistant to Cry5B-induced lethality. Unlike toxin-exposed wild-type animals, toxin-exposed mutants show only a modest reduction in fertility. Similar resistance is observed for animals exposed to E. coli produced Cry5B toxin. Mutants are similarly sensitive to Cry6A. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00004264 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000072 | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals appear morphologically normal. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals behave similarly to wild-type. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals develop from embryos to adults at the normal wild-type rate. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00039883 | |||||||
WBPaper00041118 | ||||||||
WBPaper00004264 | ||||||||
WBPaper00028852 | ||||||||
Method | Substitution_allele |