WormBase Tree Display for Variation: WBVar00275390
expand all nodes | collapse all nodes | view schema
WBVar00275390 | Evidence | Paper_evidence | WBPaper00006229 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ye13 | ||||||
Other_name | Y73E7A.7a.1:c.845delinsA | |||||||
CE49566:p.Trp117Ter | ||||||||
CE26412:p.Trp282Ter | ||||||||
Y73E7A.7a.2:c.845delinsA | ||||||||
Y73E7A.7b.1:c.350delinsA | ||||||||
HGVSg | CHROMOSOME_I:g.1622529delinsT | |||||||
Sequence_details | SMap | S_parent | Sequence | Y73E7A | ||||
Flanking_sequences | atcaatggattttcgaatgatttttggggtt | ggcggagaggacgacgatttggcgacgaga | ||||||
Mapping_target | Y73E7A | |||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00006229 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | HY | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000269 | ||||||
Transcript | Y73E7A.7a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y73E7A.7a.1:c.845delinsA | |||||||
HGVSp | CE26412:p.Trp282Ter | |||||||
cDNA_position | 943-944 | |||||||
CDS_position | 845-846 | |||||||
Protein_position | 282 | |||||||
Exon_number | 7/9 | |||||||
Codon_change | tGG/tAG | |||||||
Amino_acid_change | W/* | |||||||
Y73E7A.7b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y73E7A.7b.1:c.350delinsA | |||||||
HGVSp | CE49566:p.Trp117Ter | |||||||
cDNA_position | 361-362 | |||||||
CDS_position | 350-351 | |||||||
Protein_position | 117 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | tGG/tAG | |||||||
Amino_acid_change | W/* | |||||||
Y73E7A.7a.2 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y73E7A.7a.2:c.845delinsA | |||||||
HGVSp | CE26412:p.Trp282Ter | |||||||
cDNA_position | 879-880 | |||||||
CDS_position | 845-846 | |||||||
Protein_position | 282 | |||||||
Exon_number | 6/8 | |||||||
Codon_change | tGG/tAG | |||||||
Amino_acid_change | W/* | |||||||
Genetics | Interpolated_map_position | I | -13.697 | |||||
Description | Phenotype | WBPhenotype:0001524 | Paper_evidence | WBPaper00051118 | ||||
Curator_confirmed | WBPerson38423 | |||||||
Remark | Lethargus duration increased by 7%; total sleep increased by 14%; Bout duration increased by 4% (Table 2A) | Paper_evidence | WBPaper00051118 | |||||
Curator_confirmed | WBPerson38423 | |||||||
WBPhenotype:0002060 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Produces a brood when grown in the presence of Bt toxin Cry5B. The intestines of mutants fed Bt-produced toxin have intestinal morphology often indistinguishable from that of healthy wild-type intestine not exposed to toxin. Mutants are resistant to Cry5B-induced lethality. Unlike toxin-exposed wild-type animals, toxin-exposed mutants show only a modest reduction in fertility. Similar resistance is observed for animals exposed to E. coli produced Cry5B toxin. Mutants are similarly sensitive to Cry6A. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00005329 | Paper_evidence | WBPaper00004264 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000072 | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals appear morphologically normal. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00028852 | ||||||
Curator_confirmed | WBPerson557 | |||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00028852 | ||||
Curator_confirmed | WBPerson557 | |||||||
WBPhenotype:0000517 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals behave similarly to wild-type. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have wild-type brood sizes. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000676 | Paper_evidence | WBPaper00004264 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals develop from embryos to adults at the normal wild-type rate. | Paper_evidence | WBPaper00004264 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00006229 | |||||||
WBPaper00004264 | ||||||||
WBPaper00028852 | ||||||||
WBPaper00051118 | ||||||||
Method | Substitution_allele |