WormBase Tree Display for Variation: WBVar00275533

WBVar00275533 Evidence: Paper_evidence: WBPaper00005190
  Name: Public_name: zu223
    Other_name (11)
    HGVSg: CHROMOSOME_III:g.7584879G>A
  Sequence_details: SMap: S_parent: Sequence: R13A5
    Flanking_sequences: aattcttttttatgaatccaatggagaaat gaaagtcagacatcaactgccctataagtt
    Mapping_target: R13A5
    Type_of_mutation: Substitution: g a Paper_evidence: WBPaper00005190
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Component_of_genotype: WBGenotype00000070
    Laboratory: JJ
    Status: Live
  Affects: Gene: WBGene00000846
    Transcript: R13A5.1d.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R13A5.1d.1:c.191G>A
        HGVSp: CE46318:p.Trp64Ter
        cDNA_position: 197
        CDS_position: 191
        Protein_position: 64
        Exon_number: 2/12
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
      R13A5.1c.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R13A5.1c.1:c.257G>A
        HGVSp: CE46153:p.Trp86Ter
        cDNA_position: 257
        CDS_position: 257
        Protein_position: 86
        Exon_number: 2/11
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
      R13A5.1b.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R13A5.1b.1:c.191G>A
        HGVSp: CE30111:p.Trp64Ter
        cDNA_position: 192
        CDS_position: 191
        Protein_position: 64
        Exon_number: 2/12
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
      R13A5.1a.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R13A5.1a.1:c.191G>A
        HGVSp: CE45023:p.Trp64Ter
        cDNA_position: 191
        CDS_position: 191
        Protein_position: 64
        Exon_number: 1/11
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
      R13A5.1a.2 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R13A5.1a.2:c.191G>A
        HGVSp: CE45023:p.Trp64Ter
        cDNA_position: 214
        CDS_position: 191
        Protein_position: 64
        Exon_number: 2/12
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
      R13A5.1e.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: R13A5.1e.1:c.191G>A
        HGVSp: CE34586:p.Trp64Ter
        cDNA_position: 197
        CDS_position: 191
        Protein_position: 64
        Exon_number: 2/12
        Codon_change: tGg/tAg
        Amino_acid_change: W/*
    Interactor: WBInteraction000500585
      WBInteraction000502345
      WBInteraction000502346
      WBInteraction000502347
      WBInteraction000504401
  Genetics: Interpolated_map_position: III -0.663691
  Description: Phenotype: WBPhenotype:0000052 Paper_evidence: WBPaper00005190
        Curator_confirmed: WBPerson712
        Remark: This mutant failed to complement n3194 for maternal-effect lethality. Paper_evidence: WBPaper00005190
            Curator_confirmed: WBPerson712
      WBPhenotype:0000241 Paper_evidence: WBPaper00005190
        Curator_confirmed: WBPerson712
        Remark: The mutation zu223 was isolated in a screen for mutations with a maternal-effect lethal phenotype and observed to have excess refractile corpses in arrested embryos (J. Priess, personal communication). Paper_evidence: WBPaper00005190
            Curator_confirmed: WBPerson712
      WBPhenotype:0000867 Paper_evidence: WBPaper00005190
        Curator_confirmed: WBPerson712
        Remark: The mutation zu223 was isolated in a screen for mutations with a maternal-effect lethal phenotype and observed to have excess refractile corpses in arrested embryos (J. Priess, personal communication). Paper_evidence: WBPaper00005190
            Curator_confirmed: WBPerson712
      WBPhenotype:0002089 Paper_evidence: WBPaper00005190
        Curator_confirmed: WBPerson712
        Remark: Cells in mutants were disorganized and displayed irregular morphologies. Specifically, cup-5 mutant animals contained many cells with enlarged vacuoles or lysosomes and membranous lamellar structures that are not seen in wild-type animals. Paper_evidence: WBPaper00005190
            Curator_confirmed: WBPerson712
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00005190
            Curator_confirmed: WBPerson712
      WBPhenotype:0002234 Paper_evidence: WBPaper00005190
        Curator_confirmed: WBPerson712
        Remark: Mutants accumulated LysoTracker Red in most and possibly all tissues of the embryo. Mutants did not have excess intestinal cells that might have been responsible for the broader distribution of LysoTracker. Furthermore, mutants showed normal distribution of the mitochondrial marker MitoTracker Red. Mutant animals contain excess acidified intracellular compartments that most likely are lysosomes. Paper_evidence: WBPaper00005190
            Curator_confirmed: WBPerson712
        Variation_effect: Hypomorph_reduction_of_function: Paper_evidence: WBPaper00005190
            Curator_confirmed: WBPerson712
  Disease_info: Models_disease: DOID:0080490
    Models_disease_in_annotation: WBDOannot00000001
      WBDOannot00001000
      WBDOannot00001156
  Reference: WBPaper00005190
  Method: Substitution_allele