WormBase Tree Display for Variation: WBVar00275573
expand all nodes | collapse all nodes | view schema
WBVar00275573 | Evidence | Paper_evidence | WBPaper00036056 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ju89 | |||||||
Other_name | CE46730:p.Gly419Arg | ||||||||
F26E4.8a.1:c.1240G>C | |||||||||
F26E4.8b.1:c.1255G>C | |||||||||
CE09692:p.Gly414Arg | |||||||||
HGVSg | CHROMOSOME_I:g.9786043C>G | ||||||||
Sequence_details | SMap | S_parent | Sequence | F26E4 | |||||
Flanking_sequences | ccaagtcttcacgagcctcggtgaactctc | ctcctccattccttctccgacgtaccagtg | |||||||
Mapping_target | F26E4 | ||||||||
Type_of_mutation | Substitution | c | g | Curator_confirmed | WBPerson4055 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005447 | ||||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006528 | |||||||
Transcript | F26E4.8a.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious_low_confidence | |||||||
PolyPhen | 0.949 | possibly_damaging | |||||||
HGVSc | F26E4.8a.1:c.1240G>C | ||||||||
HGVSp | CE09692:p.Gly414Arg | ||||||||
cDNA_position | 1253 | ||||||||
CDS_position | 1240 | ||||||||
Protein_position | 414 | ||||||||
Exon_number | 4/5 | ||||||||
Codon_change | Gga/Cga | ||||||||
Amino_acid_change | G/R | ||||||||
F26E4.8b.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious_low_confidence | |||||||
PolyPhen | 0.949 | possibly_damaging | |||||||
HGVSc | F26E4.8b.1:c.1255G>C | ||||||||
HGVSp | CE46730:p.Gly419Arg | ||||||||
cDNA_position | 1255 | ||||||||
CDS_position | 1255 | ||||||||
Protein_position | 419 | ||||||||
Exon_number | 4/4 | ||||||||
Codon_change | Gga/Cga | ||||||||
Amino_acid_change | G/R | ||||||||
Interactor | WBInteraction000525371 | ||||||||
Genetics | Interpolated_map_position | I | 3.90462 | ||||||
Description | Phenotype | WBPhenotype:0000180 | Paper_evidence | WBPaper00036056 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The number of axons in the ventral nerve cord was reduced by 8% compared to wild-type worms, and the number of axons in the dorsal nerve cord was reduced by 16% | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ju89 worms exhibited multiple defects in the SNB-1::GFP pattern along both the ventral and dorsal nerve cords that suggested a failure to properly form or maintain synapses. The number of DD puncta along the dorsal nerve cord was reduced by an average of 42% in young adult ju89 worms and the number of VD puncta in the ventral nerve cord was reduced by 34%. Cholinergic motor neuron synapses are not globally disrupted in the mutants as indicated by SNT-1 Ab | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00036056 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | All ju89 adult worms showed uncoordinated (unc) movement | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000672 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Weak diffuse SNB-1 GFP was observed along commissures suggesting mislocalization of synaptic vesicles to these regions | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | DD outgrowth defects were observed in ju89 mutants | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001321 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | UNC-10::GFP puncta were frequently smaller than wild-type and irregularly spaced, and diffuse UNC-10::GFP was visible in the commissures of adult ju89 animals. | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001669 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Compared to wildtype synapses, a reduction in the number of synaptic vesicles is apparent in GABAergic and cholinergic synapses of the mutants | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001672 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Abnormal commissure branching | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001685 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Large gaps in UNC-49::GFP expression were evident along both the dorsal and ventral muscles of adult ju89 mutants, indicating that postsynaptic structures were not present in these regions. In some ju89 mutant animals the GFP-tagged receptor appeared diffused throughout the muscle tissue, consistent with the failure of the receptor to completely localize to synapses. | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0004022 | Paper_evidence | WBPaper00036056 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The amplitude of the wave pattern was greatly reduced when animals move forward | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00036056 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00036056 | ||||||||
WBPaper00051394 | |||||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||||
Method | Substitution_allele |