WormBase Tree Display for Variation: WBVar00275617
expand all nodes | collapse all nodes | view schema
WBVar00275617 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2533 | |||
Other_name | CE44996:p.Asn2747= | ||||
B0228.4a.1:c.3772+5468T>C | |||||
B0228.4c.1:c.8241T>C | |||||
HGVSg | CHROMOSOME_II:g.7735628T>C | ||||
Sequence_details | SMap | S_parent | Sequence | B0228 | |
Flanking_sequences | AGTGGTTGCTGCTGAATTTGGAATTGCAAA | GAAAGTGTTCAAAAGGCATTGGAAGTTTTG | |||
Mapping_target | B0228 | ||||
Type_of_mutation | Substitution | T | C | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00037340 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00015061 | |||
Transcript | B0228.4c.1 | VEP_consequence | synonymous_variant | ||
VEP_impact | LOW | ||||
HGVSc | B0228.4c.1:c.8241T>C | ||||
HGVSp | CE44996:p.Asn2747= | ||||
cDNA_position | 8241 | ||||
CDS_position | 8241 | ||||
Protein_position | 2747 | ||||
Exon_number | 13/25 | ||||
Codon_change | aaT/aaC | ||||
Amino_acid_change | N | ||||
B0228.4a.1 | VEP_consequence | intron_variant | |||
VEP_impact | MODIFIER | ||||
HGVSc | B0228.4a.1:c.3772+5468T>C | ||||
Intron_number | 11/21 | ||||
Isolation | Mutagen | ENU | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |