WormBase Tree Display for Variation: WBVar00275656

WBVar00275656 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5225
    Other_name: Y43H11AL.3a.2:c.-13+1191G>A
    HGVSg: CHROMOSOME_II:g.262373C>T
  Sequence_details: SMap: S_parent: Sequence: B0432
    Flanking_sequences: AATGAAAGATTCGTTAGTTTCGTGGGATCG TTGGATATAAAGTTAGCCTTCTACGCATAT
    Mapping_target: B0432
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00004166
    Transcript: Y43H11AL.3a.2 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y43H11AL.3a.2:c.-13+1191G>A
        Intron_number: 1/28
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele